Mutation lacZ4823

Name: lacZ4823
Type: Insertion
Mutation of Gene: lacZ
Approx. Map Location: 7.18
Synonyms
Designation Where Used
lacZ(+11) Seier et al., 2011
Comments
- is a compound allele replacing ATACACT-----------TGCTGATGCGG with ATACACTTGCTGATGCGGTGCTGATGCGG starting at base 2486 in the lacZ sequence. This results in an 11 basepair duplication and a frameshift mutation.
References
- Seier, T, DR Padgett, G Zilberberg, VA Sutera, N Toha, ST Lovett 2011. Insights into mutagenesis using Escherichia coli chromosomal lacZ strains that enable detection of a wide spectrum of mutational events. Genetics 188(2):247-62.
2 Strains Carrying This Mutation
Name Mutations Genotype
STL14025 4 F-, lacZ4823, mhpC281::Tn10, λ^-, rph-1
STL14027 5 F-, lacZ4823, mhpC281::Tn10, λ^-, ΔmutS738::kan, rph-1

Name	Mutations	Genotype
STL14025	4	F-, lacZ4823, mhpC281::Tn10, λ^-, rph-1
STL14027	5	F-, lacZ4823, mhpC281::Tn10, λ^-, ΔmutS738::kan, rph-1

E. coli Genetic Resources at Yale CGSC, The Coli Genetic Stock Center