CGSC Strain#: 13326
Strain Designation: SX1771      
Source of Strain: S. Xie
Sex: F- 
 Chromosomal Markers: Δ(argF-lac)169, 
gal-490, 
Δ(modF-ybhJ)803, 
λ[cI857 Δ(cro-bioA)], 
nuoE794-YFP(::cat), 
IN(rrnD-rrnE)1, 
rph-1Strain Comments: - CGSC Plate 10 Well A9
- This strain requires a Material Transfer Agreement from Harvard University prior to receiving the strain from the CGSC.   Please contact  Harvard University Office of Technology Development.
- Δ(argF-lac)169-- from strain Hfr3000 U169 was initially called  ΔlacU169 and described as a  lacZY mutation until found to include  argF and  lacI.                                                                                           
- Δ(argF-lac)169-- extends from  mmuP through orfs preceding  argF, through  lac to  mhpD, literally Δ(mmuP-mhpD)169. (Peters et al. 2003 JB 185:2017)                                                                                          
- gal-490-- This mutation has an IS2 insertion element in the mRNA leader of the gal operon preventing transcription.
- Δ(modF-ybhJ)803-- the deletion is about 13.7Kb and goes from the inergenic region between galE and modF to the intergenic region between ybhJ and ybhC.
- Δ(modF-ybhJ)803-- The sequence flanking the deletion is CGTAAACGCCTTATCCGGCCTACGGTTCGA Δ CGCATGCAGGCATGAAACCGCGTCTTTTTTC
- λ[cI857 Δ(cro-bioA)]-- In this prophage, the pL operon is intact and controlled by the temperature-sensitive Lambda repressor (cI857). A deletion of the right arm of the prophage from cro through the right attachment site, and extends into the bacterial bioA gene
- nuoE794-YFP(::cat)-- This allele is a protein fusion to the Venus YFP followed by the chloramphenicol resistance gene cat under its own promoter.
- IN(rrnD-rrnE)1-- Inverts the region between rrnD (73.74 min) and rrnE (90.66 min)
- rph-1-- is a 1 bp deletion that results in frameshift over last 15 codons and has polar effect on  pyrE leading to suboptimal pyrimidine levels on minimal medium.(Jensen 1993 JBact.175:3401)                                                                  
- Δ(modF-ybhJ)803 was formerly called 
References:- Taniguchi, Y, PJ Choi, GW Li, H Chen, M Babu, J Hearn, A Emili, XS Xie 2010. Quantifying E. coli proteome and transcriptome with single-molecule sensitivity in single cells. Science 329(5991):533-8.