CGSC Strain#: 12402
Strain Designation: STL15654     
Source of Strain: S.T. Lovett
Sex: F-
Chromosomal Markers: lacZ4822,
mhpC281::Tn10,
λ-,
rph-1Strain Comments: - lacZ4822-- is a compound allele replacing TTTG-C--CTGGT-TTCCGGCACCAGAA with TTTGCCAGCTTCTCTTCCGGCACCGGAA starting at base 181 in the lacZ sequence. This results in a frameshift mutation and the formation of a quasipalendrome.
- mhpC281::Tn10-- cotransduces 80% with lac.
- rph-1-- is a 1 bp deletion that results in frameshift over last 15 codons and has polar effect on pyrE leading to suboptimal pyrimidine levels on minimal medium.(Jensen 1993 JBact.175:3401)
- lacZ4822 was formerly called lacZ(QP6)
- mhpC281::Tn10 was formerly called zah281::Tn10
- = tetracycline resistant
References: - Seier, T, DR Padgett, G Zilberberg, VA Sutera, N Toha, ST Lovett 2011. Insights into mutagenesis using Escherichia coli chromosomal lacZ strains that enable detection of a wide spectrum of mutational events. Genetics 188(2):247-62.