CGSC Strain#: 12402
Strain Designation: STL15654      Source of Strain: S.T. Lovett
Sex: F- Chromosomal Markers: lacZ4822, mhpC281::Tn10, λ^-, rph-1
Strain Comments:

• lacZ4822-- is a compound allele replacing TTTG-C--CTGGT-TTCCGGCACCAGAA with TTTGCCAGCTTCTCTTCCGGCACCGGAA starting at base 181 in the lacZ sequence. This results in a frameshift mutation and the formation of a quasipalendrome.
• mhpC281::Tn10-- cotransduces 80% with lac.
• rph-1-- is a 1 bp deletion that results in frameshift over last 15 codons and has polar effect on pyrE leading to suboptimal pyrimidine levels on minimal medium.(Jensen 1993 JBact.175:3401)
• lacZ4822 was formerly called lacZ(QP6)
• mhpC281::Tn10 was formerly called zah281::Tn10
• = tetracycline resistant

References:

• Seier, T, DR Padgett, G Zilberberg, VA Sutera, N Toha, ST Lovett 2011. Insights into mutagenesis using Escherichia coli chromosomal lacZ strains that enable detection of a wide spectrum of mutational events. Genetics 188(2):247-62.