CGSC Strain#: 11578
Strain Designation: JW5786-1     
Source of Strain: Keio Collection
Other Designations: JW5786
Sex: F-
Chromosomal Markers: Δ(araD-araB)567,
ΔlacZ4787(::rrnB-3)
,
λ-,
rph-1,
Δ(rhaD-rhaB)568,
ΔyjiM734::kan,
hsdR514Strain Comments: - From the Keio Collection of single-gene knockouts constructed through a collaboration of the Inst. of Adv. Biosci. at Keio Univ., the Nara Inst. of Sci. and Technol., Japan and Purdue Univ., USA
- Δ(araD-araB)567-- This deletion extends from ~25 bp upstream of the araB start codon to ~8 bp into the beginning of the araD gene
- ΔlacZ4787(::rrnB-3)-- : 4 tandem copies of the rrnB transcriptional terminator inserted by gene replacement into the region extending from near the SacII site near the N-terminus of lacZ through the promoter.
- rph-1-- is a 1 bp deletion that results in frameshift over last 15 codons and has polar effect on pyrE leading to suboptimal pyrimidine levels on minimal medium.(Jensen 1993 JBact.175:3401)
- ΔyjiM734::kan-- The primers used to make this knockout were ATGCCAATCGAATATGCCACTGCCACTCCTTACAGCATCTCAATAAAGGCATTCCGGGGATCCGTCGACC and AATGTGGCCTCTTTTCATTATCTCCCGTGGTACGGGGAAGGAAAATCATGTGTAGGCTGGAGCTGCTTCG the bolded sequence matches the pKD13 template
- Δ(araD-araB)567 was formerly called Δ araBADAH33
- Δ(rhaD-rhaB)568 was formerly called Δ rhaBADLD78
- ΔlacZ4787(::rrnB-3) was formerly called ::rrnB-4
- ΔlacZ4787(::rrnB-3) was formerly called Δ lacZWJ16
- = kanamycin resistant
- ::rrnB-3 = 4 copies of rrnB inserted
References: - Baba, T., T. Ara, M. Hasegawa, Y. Takai, Y. Okumura, M. Baba, K.A. Datsenko, M. Tomita, B.L. Wanner, H. Mori 2006. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol 2:1-11